Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.001681 |
Chromosome: | chromosome 7 |
Location: | 3843586 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g338800 | CGL125 | (1 of 4) PF04676 - Protein similar to CwfJ C-terminus 2 (CwfJ_C_2); Conserved in the Green Lineage | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGGGCGCAATGGCAGTGGCGGGGCAGTGCACCGGGTGACACTAGCAT |
Internal bar code: | GGCCACGCCGTGTCGTCTTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 267 |
LEAP-Seq percent confirming: | 14.2857 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTTGAGCTGCTTCAGGA |
Suggested primer 2: | GTGTTTGCCTGCTGTAACGG |