Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.001715 |
Chromosome: | chromosome 12 |
Location: | 5614917 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g531350 | CGL62 | putative cell cycle associated protein; (1 of 3) PF10497 - Zinc-finger domain of monoamine-oxidase A repressor R1 (zf-4CXXC_R1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAGAAGGCTGTCGAACGGCCGTCAATCCTTACACACCCTCACGGTCGC |
Internal bar code: | AACACTAAGAATATTTAAGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1333 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACTACCCTCCTCTGAGCC |
Suggested primer 2: | CAGAGAACTGACTGCCGGTT |