Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.001789 |
Chromosome: | chromosome 7 |
Location: | 1097935 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g320350 | CDJ5 | (1 of 3) PF00226//PF13370 - DnaJ domain (DnaJ) // 4Fe-4S single cluster domain of Ferredoxin I (Fer4_13); Chloroplast DnaJ-like protein 5 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATATGGGGCGCCAGCGTCGGCGGGAAACAACATGATCTCGCACAGTGGCC |
Internal bar code: | GTTGCTCTGATTAGCTGGATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 726 |
LEAP-Seq percent confirming: | 57.1429 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAGGGGGTATGGGCGGTTA |
Suggested primer 2: | TAGCGCTGGTGTTGTGTGAT |