| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001808 |
| Chromosome: | chromosome 6 |
| Location: | 2823330 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g271950 | CGL135,GC6 | (1 of 1) PTHR10013 - GENERAL VESICULAR TRANSPORT FACTOR P115; Conserved in the green lineage 135 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCTGCTCCCTTACCTCCCCCCGGCAACGACGCGCCTTCTGTACCAATG |
| Internal bar code: | AGGTTATTGCTCCTTTCAACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCGCATTCACCGGTATGC |
| Suggested primer 2: | CCGTACACAACCCATCACCA |