Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.001866 |
Chromosome: | chromosome 2 |
Location: | 2738678 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g093750 | NRX2 | Nucleoredoxin 2; (1 of 3) K17609 - nucleoredoxin [EC:1.8.1.8] (NXN) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGACTCACTGCTCGGCCCCAACGGCACTCAGGTGCCTGTCTCCAGCA |
Internal bar code: | CTGAGGTACTGCAAGCGGGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5544 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 78 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGATGACCAGGGTAGGGA |
Suggested primer 2: | CACACTAGAGCGATCGTCCC |