Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.001884 |
Chromosome: | chromosome 4 |
Location: | 1688084 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212401 | UBC15 | (1 of 2) K10586 - baculoviral IAP repeat-containing protein 6 (apollon) (BIRC6, BRUCE); E2 Ubiquitin conjugating enzyme | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGATGACATGATGACAACGAGGAAAAAGGCGTGAGGAGAGCGAAAACGT |
Internal bar code: | CCGTCCGCCCGTGTTAGGGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1349 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTATGTGGAGGAGATGCGGG |
Suggested primer 2: | TTTGCACTGTCGCACACATG |