| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001893 |
| Chromosome: | chromosome 13 |
| Location: | 3821727 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g589200 | (1 of 21) IPR011016 - Zinc finger, RING-CH-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACCACCGACCCTGTTGCCACAGAAAGCAGCAACCAGCAGCAAACATCG |
| Internal bar code: | TAGTTTGTAGCCCCCCAATAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2618 |
| LEAP-Seq percent confirming: | 92.5926 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTATGGGGCTGATGGGCTT |
| Suggested primer 2: | ATTCGACGGCCTTGACTTGT |