| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.001899 |
| Chromosome: | chromosome 10 |
| Location: | 2361792 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g434750 | AAI1 | (1 of 1) 1.1.1.86 - Ketol-acid reductoisomerase (NADP(+)) / Dihydroxyisovalerate dehydrogenase (isomerizing); Acetohydroxy acid isomeroreductase | 3'UTR |
| Cre10.g434800 | (1 of 1) PF00515//PF02151//PF13414 - Tetratricopeptide repeat (TPR_1) // UvrB/uvrC motif (UVR) // TPR repeat (TPR_11) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTGGAGAAGTGGATGTGCGATGAGGAAGGGTGAGTTGATACAACGCC |
| Internal bar code: | GGGTTGGTGAATGAAGTAGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4211 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 102 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 102 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCCCGCTTCGACTACATC |
| Suggested primer 2: | TCGCACTTCTTCTCGGCTTT |