| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001927 |
| Chromosome: | chromosome 12 |
| Location: | 481447 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494550 | RNP10 | RNA binding protein; (1 of 3) K14947 - epithelial splicing regulatory protein 1/2 (ESRP1_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGATCGCGCCCATCCTGAGAAGCTTCCGAAGCTCGCACCTGAATCAA |
| Internal bar code: | GTAGTGACTGCTTAGCGTAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2401 |
| LEAP-Seq percent confirming: | 95.082 |
| LEAP-Seq n confirming: | 58 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCTCGATTCGGACATCC |
| Suggested primer 2: | ACATGCAAGATGACTCCGCA |