| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001930 |
| Chromosome: | chromosome 17 |
| Location: | 602022 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g699900 | AKR10 | Aldo/keto reductase; (1 of 2) PTHR11732:SF255 - ARYL-ALCOHOL DEHYDROGENASE YPL088W-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTAAAACCAATGCCCCACACGACAGAAGTCGATGCCACATTCACGGACT |
| Internal bar code: | TAGGGTGGTGTACACCACGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1511 |
| LEAP-Seq percent confirming: | 50.6849 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACTGGT |
| Suggested primer 2: | TCTCCCTGCCTCTCATCACA |