Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.001958 |
Chromosome: | chromosome 10 |
Location: | 870428 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g423650 | PRPL11 | Chloroplast ribosomal protein L11; (1 of 1) PTHR11661//PTHR11661:SF7 - 60S RIBOSOMAL PROTEIN L12 // 50S RIBOSOMAL PROTEIN L11, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGACCACCACGGTACTCCCGTGTCGGATCCATCGGCAAACTGTTTGC |
Internal bar code: | TGTCATGCTCTGTTGAAGTCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4247 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCAGACCGTTGAGTTCGT |
Suggested primer 2: | GTAACTGGGTGCGAGGAACA |