| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001995 |
| Chromosome: | chromosome 6 |
| Location: | 5570612 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287176 | CPLD67 | dihydrolipoyllysine-residue acetyltransferase; (1 of 5) PF01713 - Smr domain (Smr) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGCGCCGCAGGACGTTGAGCCCCAGCCGGCTGCGGCCCTCCGCGTCGC |
| Internal bar code: | TTGCTCAAGCACTAAAATTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2677 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGAGAAATTCGCACGGGC |
| Suggested primer 2: | TTTCACTTGTGCGCTTGCTC |