| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.002131 |
| Chromosome: | chromosome 12 |
| Location: | 768861 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g492450 | SPL18 | (1 of 2) PTHR18934:SF145 - ATP-DEPENDENT RNA HELICASE DHX57-RELATED; ATP-dependent RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAAGCGAACCATGCCTGGAAACCCGCCCTCGCAACGGCCAAACCCGT |
| Internal bar code: | AGGGGGCTCGTGGGACTAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 82.0513 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTACAACCCCTCTCCCCC |
| Suggested primer 2: | AAAACCGCTCCTCCGTGAAT |