| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.002147 |
| Chromosome: | chromosome 17 |
| Location: | 3532019 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g724600 | PAO2,TIC55-2 | Pheophorbide a oxygenase-related protein; (1 of 3) K13071 - pheophorbide a oxygenase (PAO, ACD1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGTAGCGTTTGGCCGCTCACAACGACATGCTGCGGCCGCAGGTGGCAG |
| Internal bar code: | GATTTTAGTTTGGTAAAAGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2135 |
| LEAP-Seq percent confirming: | 91.3043 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAAGTTCTCAGCCAGGA |
| Suggested primer 2: | CCTAGGTTTGGGAGTCGCTG |