| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.002165 |
| Chromosome: | chromosome 13 |
| Location: | 1105295 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g569250 | CGLD9 | Conserved in the Green Lineage and Diatoms; (1 of 1) PF11255 - Protein of unknown function (DUF3054) (DUF3054) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTCATCTCCTAGTGGCTCCCGACACCCCTCTTACATAACCCGACAGCC |
| Internal bar code: | CGGGATCTTGGATCGTGGAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2296 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTTGCTGGGCAACTTTC |
| Suggested primer 2: | GAACTCTCAACCTCCAGCCC |