| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.002193 |
| Chromosome: | chromosome 16 |
| Location: | 5820130 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g679950 | RFC3 | DNA replication factor C complex subunit 3; (1 of 1) PTHR11669:SF1 - REPLICATION FACTOR C SUBUNIT 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGAGAGCAGGTATGGGAGGTGGCGGCGAGGACGGAGGGGTTGTAGAT |
| Internal bar code: | GGACCTAGGATGTTGGGAAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3377 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGACATGCAACCTACGGT |
| Suggested primer 2: | CCCTACCTTCCCCTCTCCTC |