Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.002218 |
Chromosome: | chromosome 7 |
Location: | 5071245 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g347850 | (1 of 1) PF08123 - Histone methylation protein DOT1 (DOT1) | 3'UTR | |
Cre07.g347900 | (1 of 2) IPR001680//IPR001810//IPR017986 - WD40 repeat // F-box domain // WD40-repeat-containing domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCCTGCAGACTCGTCGCACTCGCTCGGCCACACAGCCGCGACGGCG |
Internal bar code: | CCACAGGTTCCGATAGCGTTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2813 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 41 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGCTGGGAGGCTGATCAA |
Suggested primer 2: | TCTATTGTTGCTGCTGGCGA |