| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.002218 |
| Chromosome: | chromosome 7 |
| Location: | 5071248 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347850 | (1 of 1) PF08123 - Histone methylation protein DOT1 (DOT1) | 3'UTR | |
| Cre07.g347900 | (1 of 2) IPR001680//IPR001810//IPR017986 - WD40 repeat // F-box domain // WD40-repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTTGGGGCTCGCGGTGGGTGAGGGACGGGCGGACACCTCGCAAGATA |
| Internal bar code: | CCACAGGTTCCGATAGCGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1750 |
| LEAP-Seq percent confirming: | 95.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTATTGTTGCTGCTGGCGA |
| Suggested primer 2: | CAAGCTGGGAGGCTGATCAA |