Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.002254 |
Chromosome: | chromosome 2 |
Location: | 2015856 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g088450 | CPLD29 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR22999:SF18 - PX DOMAIN-CONTAINING PROTEIN KINASE-LIKE PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCGGAAGCGCCGCGCCACCGTCCACTCCCGCGGCCCCGCCGCCTCCT |
Internal bar code: | AGGGCAAAAGCTCGTCTGAGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1732 |
LEAP-Seq percent confirming: | 89.4737 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCACATCGCTTCGGAATTC |
Suggested primer 2: | CAGGGACTTGAAGCTGAGGG |