| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.002310 |
| Chromosome: | chromosome 16 |
| Location: | 6655875 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g673550 | CGLD36 | (1 of 1) 2.7.1.100//5.3.1.23 - S-methyl-5-thioribose kinase / MTR kinase // S-methyl-5-thioribose-1-phosphate isomerase / S-methyl-5-thio-D-ribose-1-phosphate aldose-ketose-isomerase; 5-methyl thioribose kinase-related protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGTGGCCCCTTGCCACCTGCTCGACTGCCCCACAGCTCAAAATATCA |
| Internal bar code: | GTGCTAGTGGTGAAGCGAGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGAGGAGGATGGAGGAGG |
| Suggested primer 2: | ATCGTCAAGACCTCCCTCCA |