| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.002376 |
| Chromosome: | chromosome 16 |
| Location: | 1930284 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g656050 | (1 of 26) IPR000209 - Peptidase S8/S53 domain | 3'UTR | |
| Cre16.g656100 | (1 of 1) PF07444 - Ycf66 protein N-terminus (Ycf66_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTAACAAGCCCCAACAGGCAATCCATCCACAGCAGAACGGTCCCCCAG |
| Internal bar code: | GGGACGAAGGCCGTATGGGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2836 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAGCTCTACCAAGCCCTCT |
| Suggested primer 2: | GTGTTGTTTGGAGGCTGCAG |