Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.002397 |
Chromosome: | chromosome 12 |
Location: | 3248716 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g499500 | SAC3,SNRK2B | snRK1 family in Chlamydomonas, subgroup 2; (1 of 1) PTHR24343:SF207 - SERINE/THREONINE-PROTEIN KINASE SRK2C | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCGCGTGATGGGGGCAGTGCATCAGGCCGGCGCCAACCGCACGCCA |
Internal bar code: | GCCGACTGGGCTGTGGGTCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3602 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGGAGATGGGCGCTGAAT |
Suggested primer 2: | GACCGCATACTGACTCCTCG |