| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.002465 |
| Chromosome: | chromosome 12 |
| Location: | 9891292 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541777 | CGL95 | (1 of 1) 2.1.1.259//2.1.1.43 - [Fructose-bisphosphate aldolase]-lysine N-methyltransferase / (dimerizing)]-lysine 6-N-methyltransferase // Histone-lysine N-methyltransferase / Protein-lysine N-methyltransferase; SET domain-containing protein | 3'UTR |
| Cre12.g542202 | (1 of 1) PTHR12149:SF8 - MGC174333 PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATGCGACGCCACACCGCGCGGATAGCATAGCCGATGGGCTGGCACGC |
| Internal bar code: | GTTATTAAGGTCACATAGGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1680 |
| LEAP-Seq percent confirming: | 52.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAAAGAAGGGCAGCAAG |
| Suggested primer 2: | GCTGTATTAGCGGCTAGGCA |