Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.002679 |
Chromosome: | chromosome 13 |
Location: | 1699094 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g574200 | PAP2 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCTCTACACAGGCTACGAGATCAATGACCGCGGCCGCATCACGGCCA |
Internal bar code: | GACCTCGCTGTGCCTCTCGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3609 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGGTCCACAGCTGCAAAC |
Suggested primer 2: | GTCATGGCTACTACGGGAGC |