Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.002716 |
Chromosome: | chromosome 16 |
Location: | 6446811 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g675100 | CPLD53 | Conserved in the Plant Lineage and Diatoms; (1 of 3) PTHR31319:SF10 - ZINC FINGER PROTEIN CONSTANS-RELATED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAAACTATTGGATGCTTTACTGTGCATCAAGTTTTATTGTTAGCAGTG |
Internal bar code: | GGGAATGCGGGACGTGTATAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 412 |
LEAP-Seq percent confirming: | 75.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGATTCGTGGTCCACAGTGT |
Suggested primer 2: | GCTCGCAGTAGTAGCCTCTG |