| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.002724 |
| Chromosome: | chromosome 14 |
| Location: | 1018813 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614000 | CGL17 | Conserved in the Green Lineage; (1 of 1) PTHR35699:SF1 - F2J10.10 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAACTGCTAAGTACTTGCCGGCTCCCATGTCACCCTCCCGCCCACGCC |
| Internal bar code: | GTTGATTTGTACGCAGTTGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 278 |
| LEAP-Seq percent confirming: | 42.8571 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCGAAAACACGCTTTGGT |
| Suggested primer 2: | GTACACACACACACGCACAC |