| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.002744 |
| Chromosome: | chromosome 3 |
| Location: | 5285330 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182550 | PNO3 | FAD-dependent pyridine nucleotide-disulphide oxidoreductase; (1 of 1) 1.18.1.3 - Ferredoxin--NAD(+) reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGTAGCGTGTCATTCTGCCATTTGCAAGGGGTACGCCTGGAAAGTCA |
| Internal bar code: | TGAGAGGATGGAGGGGTGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1568 |
| LEAP-Seq percent confirming: | 94.2857 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCAGGGATGCTGCTGTAT |
| Suggested primer 2: | TTCTGGCTGTTCCTGCTACG |