| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.002765 |
| Chromosome: | chromosome 8 |
| Location: | 2510005 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372550 | CDKB1,DIV48 | plant specific cyclin dependent kinase; (1 of 1) K07760 - cyclin-dependent kinase [EC:2.7.11.22] (CDK) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGTGGCTGTGATGGCATGTGCCCTATTGTACATACGTAGTATGGGCCC |
| Internal bar code: | TGCTGGTCACGCTGCGTAGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 196 |
| LEAP-Seq percent confirming: | 1.85185 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTCCGCAACCACTTCACC |
| Suggested primer 2: | CGGTATGGCTCGAGATGCTT |