| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.002766 |
| Chromosome: | chromosome 13 |
| Location: | 1279554 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g570851 | PSB34 | PSII assembly protein; (1 of 1) PTHR35753//PTHR35753:SF1 - FAMILY NOT NAMED // PROLINE-RICH FAMILY PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGTTGCTCACGACCAGGCCCCAGGCGGGTGCAACAGCGCCCGAAAGGC |
| Internal bar code: | TTCTGGTATCTTGTTCGAAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3742 |
| LEAP-Seq percent confirming: | 96.5753 |
| LEAP-Seq n confirming: | 141 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 146 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCGTTGTTGAAGTTGTCC |
| Suggested primer 2: | GCTACTTTTTAGGCGCTCGC |