Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.002805 |
Chromosome: | chromosome 3 |
Location: | 548520 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g145207 | CPLD33 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR36359:SF1 - RESISTANCE TO PHYTOPHTHORA 1 PROTEIN | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACTTGGTGGACGAGCGGGGCGCGAAGGTGCCGGCAATCTGGCGCGTG |
Internal bar code: | AGCATTCGGTAACTGTATAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 552 |
LEAP-Seq percent confirming: | 38.4615 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCACTCGAGGATCCAGC |
Suggested primer 2: | ACCTCAATGCCATCCCACAG |