Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.002845 |
Chromosome: | chromosome 10 |
Location: | 5777950 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g460050 | FLU1,FLU,FLP | (1 of 1) PTHR10098//PTHR10098:SF123 - RAPSYN-RELATED // SUBFAMILY NOT NAMED; FLU protein, chloroplast precursor | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTACGGGGCTACACCACAGAACAATGCTGCGATGCGGTGGCGAAGCGAA |
Internal bar code: | AAACCACATACTCGTAGTATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1872 |
LEAP-Seq percent confirming: | 86.2069 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 87 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGGTGGATGTGCCTATT |
Suggested primer 2: | GACGGAAGGCTGGAGGAAAA |