| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.002907 |
| Chromosome: | chromosome 10 |
| Location: | 2517881 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436000 | POC2 | Proteome of centriole protein 2; (1 of 2) PTHR10877//PTHR10877:SF135 - POLYCYSTIN-RELATED // SUBFAMILY NOT NAMED | intron |
| Cre10.g436050 | FSD1 | Fe superoxide dismutase; (1 of 1) PTHR11404//PTHR11404:SF8 - SUPEROXIDE DISMUTASE 2 // SUPEROXIDE DISMUTASE [FE] 1, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGCTGGCCAGCGCCGCGCTGTGCGCCCCGCTTCGGGCCGTCGCGCT |
| Internal bar code: | GGGTTCCAGCTACGTTTACTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2290 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGTCAAAGAACCGTGTGC |
| Suggested primer 2: | CCGTGTAGTACAGCCGATCC |