| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.002923 |
| Chromosome: | chromosome 2 |
| Location: | 3367924 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g098200 | CGL103,PRT1 | (1 of 1) PF00569//PF13920 - Zinc finger, ZZ type (ZZ) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3); Conserved in the Green Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAAGCCAGGGGGGTGGCGCTTGGGCGTTGTTTGTCGGGGTTGTTGCTG |
| Internal bar code: | TACCCTCCGACTAGGAGAGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2038 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTTCTCATCGCTCTCCTC |
| Suggested primer 2: | CGTGTGTGCATCAAGGTGTG |