Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.002950 |
Chromosome: | chromosome 2 |
Location: | 2425005 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g091400 | CLPB2 | (1 of 1) IPR001270//IPR003593//IPR003959//IPR024064//IPR027417 - ClpA/B family // AAA+ ATPase domain // ATPase, AAA-type, core // FdhE-like // P-loop containing nucleoside triphosphate hydrolase; ClpB chaperone, Hsp100 family | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGGGATTGAGAAAACTACCGCCAGCCCCGGAGCCCTGTAGAAGCGCA |
Internal bar code: | CCTAACGAAAACCATAGTTCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1028 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 20 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGACAGTACCACCAGCAG |
Suggested primer 2: | GGAAAGCATCGGGTGGGTAA |