| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.002978 |
| Chromosome: | chromosome 6 |
| Location: | 2981646 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g273850 | HTB7 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGCTTTTAGCCCGAGGTGAACTTGGTCACGGCCTTGGTGCCCTCCGAC |
| Internal bar code: | ATCACTACCGATAAACTTTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2807 |
| LEAP-Seq percent confirming: | 96.9231 |
| LEAP-Seq n confirming: | 63 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCCTTCTTCAGGTAGCG |
| Suggested primer 2: | CAAATAGGACCATGCGCACG |