| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.002988 |
| Chromosome: | chromosome 8 |
| Location: | 3537256 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g379200 | CPLD18 | Conserved in the Plant Lineage and Diatoms; (1 of 1) PTHR33471//PTHR33471:SF5 - FAMILY NOT NAMED // EXPRESSED PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCAAGAAAGGCGCAGAGCAACAGTTGGCATACATACTTGAGAACTT |
| Internal bar code: | GCAGTCGAACCCAGGATTAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 333 |
| LEAP-Seq percent confirming: | 4.7619 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTGCTGTCAGTGGTTAT |
| Suggested primer 2: | TCTCCTCCTCCCGCTCTAAC |