| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.003014 |
| Chromosome: | chromosome 13 |
| Location: | 4257263 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592050 | DAL1 | Allantoinase; (1 of 1) 3.5.2.5 - Allantoinase | intron |
| Cre13.g592100 | (1 of 1) PF00097//PF00628 - Zinc finger, C3HC4 type (RING finger) (zf-C3HC4) // PHD-finger (PHD) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGAAGAAGATGCGGGCGTACACTGCGACCCCGCTTACAGTCCGCCTTA |
| Internal bar code: | AATTATGCCGTTTGAGCGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1606 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCTGTTCTCCTCAGCCAC |
| Suggested primer 2: | GCCCCATGCCTTAAGGAAGT |