| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.003144 |
| Chromosome: | chromosome 7 |
| Location: | 2780123 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g331475 | (1 of 5) PTHR23091:SF255 - ACYL-COA N-ACYLTRANSFERASES-LIKE PROTEIN | intron | |
| Cre07.g331500 | CLPR3 | (1 of 2) PTHR10381//PTHR10381:SF18 - ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT // SUBFAMILY NOT NAMED; inactive subunit of chloroplast ClpP complex | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCATCACATCACATCCCAGCACAATTCGTCCCTCGCACTACAAACTGG |
| Internal bar code: | TCAAGTCTTTCGGGCTCTTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1147 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAGTTGTACCTGCCGGTG |
| Suggested primer 2: | CCCCACCTGACGAGTTGAAA |