| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.003151 |
| Chromosome: | chromosome 16 |
| Location: | 1455016 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g652550 | PRPL24 | (1 of 1) PTHR12903:SF1 - 50S RIBOSOMAL PROTEIN L24, CHLOROPLASTIC; Chloroplast ribosomal protein L24 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTCTTAGGAGGGGTCTAGAGGCCCAGAACACTTTCTTAGACTCTAGAC |
| Internal bar code: | AAGCGATGGGTGGGAGAAGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4046 |
| LEAP-Seq percent confirming: | 93.7008 |
| LEAP-Seq n confirming: | 119 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 127 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCCCAGTCTCGTTCTCC |
| Suggested primer 2: | AAACTAGAGCAAGTGGGGCC |