| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.003257 |
| Chromosome: | chromosome 8 |
| Location: | 3008252 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g374950 | (1 of 6) PF02582 - Uncharacterised ACR, YagE family COG1723 (DUF155) | 3'UTR_intron | |
| Cre08.g375000 | DSP | (1 of 1) PF09192 - Actin-fragmin kinase, catalytic (Act-Frag_cataly); Dual-Specificity Protein Phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCCGCCGTCGCAGTGCGCGCTGCTGTCCTCGCCGCCGGGCGCCGGAGC |
| Internal bar code: | GGTCATACTGCGGTGTTGAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 679 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTAGGTGCGACCACTTG |
| Suggested primer 2: | CGACGGTGAGTGTGTGTGTA |