| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.003321 |
| Chromosome: | chromosome 12 |
| Location: | 2020875 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g510650 | FBP2,FBP1 | Fructose-1%252C6-bisphosphatase, chloroplastic; (1 of 1) K03841 - fructose-1,6-bisphosphatase I (FBP, fbp) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCTTGCTGCGCGCCGGTGAAGGCATAGTACCCGTTGAGGATAGAGCCG |
| Internal bar code: | CTTGGACGTCTGCCATCCTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4953 |
| LEAP-Seq percent confirming: | 97.9253 |
| LEAP-Seq n confirming: | 236 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 241 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCCGGAGAGGTCATAGC |
| Suggested primer 2: | CAAGCTCGCCATCGATTGTG |