| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.003346 |
| Chromosome: | chromosome 1 |
| Location: | 4437295 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030250 | (1 of 1) 3.1.3.57 - Inositol-1,4-bisphosphate 1-phosphatase / Inositol polyphosphate 1-phosphatase | 5'UTR | |
| Cre01.g030300 | (1 of 2) PF08627 - CRT-like, chloroquine-resistance transporter-like (CRT-like) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGCGCGTACTCGGCTCTGAGGGCCCTCCAGAGCCGGATGCCGCATCAA |
| Internal bar code: | TGCCCGTTATACGGCGCCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 5.26316 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGAGGAGGACGTGAGGT |
| Suggested primer 2: | ACGGCCTGGACAGCAAATTA |