| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.003377 |
| Chromosome: | chromosome 10 |
| Location: | 6425624 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464650 | CGL36 | (1 of 1) PF12646 - Domain of unknown function (DUF3783) (DUF3783); Conserved in the Green Lineage | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAAATATTGCGGGTTTGGCTGGCTTGGCGTGTGCCGGCAGGTGCTCG |
| Internal bar code: | CGAAGATGAGGTGGCGTATATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3246 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACGACACAAGGGACAGCC |
| Suggested primer 2: | ACATGTAAACCCGTGCCCAT |