| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.003404 |
| Chromosome: | chromosome 15 |
| Location: | 516501 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636050 | CPLD31 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PTHR35514//PTHR35514:SF1 - FAMILY NOT NAMED // THYLAKOID LUMENAL 15.0 KDA PROTEIN 2, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCTTACCAAAGCCCCCAACCTCGACGCCCCCATCCAAGCTGCCCCACA |
| Internal bar code: | TACATATAATTAAAGGCAACTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2298 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCTCGACATGTCAACACA |
| Suggested primer 2: | CCATTGGCGGATTGATGCAG |