| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.003465 |
| Chromosome: | chromosome 14 |
| Location: | 3912251 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632775 | (1 of 1) K03035 - 26S proteasome regulatory subunit N5 (PSMD12, RPN5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTCCCCTCCTTCCACGTGGAACACACAACCGCTAGACGCCGGCACTT |
| Internal bar code: | AACGGTAAAGTGTGATTGCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 317 |
| LEAP-Seq percent confirming: | 53.3333 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACACCGACTCGCTTATGCA |
| Suggested primer 2: | GGCGGCATCACAAAAACACT |