Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.003492 |
Chromosome: | chromosome 1 |
Location: | 3840162 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g025150 | CPLD15 | conserved organelle protein with lipase active site; (1 of 1) PTHR11440:SF48 - HYDROLASE-LIKE PROTEIN | 5'UTR |
Cre01.g025200 | MMP4 | Metalloproteinase of VMP family; (1 of 40) 3.4.24.38 - Gametolysin / Lysin | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCCAGTCCCGCCCTGTGGCGACACCAAGCCCAAGCTACCCTAGACTGC |
Internal bar code: | CTTAGGGACTATGGACATCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1444 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGGGGACACTTTGTTGCG |
Suggested primer 2: | CTTGTGTACACGGCTCTGGT |