| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.003512 |
| Chromosome: | chromosome 3 |
| Location: | 175003 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144031 | 5'UTR | ||
| Cre03.g144064 | (1 of 24) IPR001478 - PDZ domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGGTATAATATTGCATCATAGATAATAGCATTACAAGTGTCCAGTCCC |
| Internal bar code: | GTTAGAGTGTATAGCTGATATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1139 |
| LEAP-Seq percent confirming: | 39.4737 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTACACCCGTCCTCAACCC |
| Suggested primer 2: | CTCGTCCTCTCATCGAACCG |