| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.003522 |
| Chromosome: | chromosome 12 |
| Location: | 5615633 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531350 | CGL62 | putative cell cycle associated protein; (1 of 3) PF10497 - Zinc-finger domain of monoamine-oxidase A repressor R1 (zf-4CXXC_R1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAACGTTTGTGCTCTGCTCACAGGGCGGCAAGCTGTACGACAGCGCC |
| Internal bar code: | GCAATGCTTCCGAGTTCCCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6108 |
| LEAP-Seq percent confirming: | 94.6429 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAAGCAAGGCGGTATGTT |
| Suggested primer 2: | GTCGACCCGGGATATCAACC |