Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.003536 |
Chromosome: | chromosome 7 |
Location: | 828561 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g318350 | CGL64 | (1 of 4) PF12576 - Protein of unknown function (DUF3754) (DUF3754); Conserved in the Green Lineage | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTTACGGTAACAACATCATTGCCTCCCCTCCTCCTACACCCCCATCC |
Internal bar code: | GGAAGAAAGGCCACTCGCATTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 668 |
LEAP-Seq percent confirming: | 92.3077 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCAACCTTACGAGCAGCA |
Suggested primer 2: | CAGAAGTTGCAGCGTGCTTT |