| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.003592 |
| Chromosome: | chromosome 12 |
| Location: | 559821 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494000 | CGL82 | (1 of 2) IPR002083//IPR008974 - MATH/TRAF domain // TRAF-like; Conserved, expressed protein with meprin and TRAF homology domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCTTATCGAATATAGGTAGGGACTGTATGATACACGTATGTGATTGAA |
| Internal bar code: | GGTGCAAGGCCATCAGTGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5663 |
| LEAP-Seq percent confirming: | 98.7342 |
| LEAP-Seq n confirming: | 78 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGCTGTGGGAGTGTTAT |
| Suggested primer 2: | GACAAGTGGTTGCACACGTC |